1Institute of Horticultural Biotechnology, Fujian Agriculture and Forestry University, Fuzhou, China;
2College of Life Science, Ningde Normal University, Ningde, China;
3The Government of Yantian, Ningde, China;
4Industry and University Research Cooperation Demonstration Base in Fujian Province, Ningde Normal University, Ningde, China
The increasing incidence of anthracnose disease in tea plant caused by Colletotrichum has become an important global concern. It is the cause of withered leaves of the tea plant, leading to a considerable decrease in the economic yield of tea, and thereby threatening the sustainable development of tea industries. In this study, Colletotrichum infected tea leaves were collected from three separate regions: Zhouning, Longyan, and Ningde in Fujian province, China. The pathogen was isolated from the leaves and identified based on morphology following Koch’s postulates and DNA sequencing of the nuclear rDNA internal transcribed spacer (ITS) region, beta-tubulin 2 (β-Tub2), the large sub-unit of the nuclear ribosomal RNA gene (LSU), Glutamine synthetase (GS), and an oligonucleotide primer (CgInt). A total of six strains were identified with different cultural, morphological, and molecular characteristics. Furthermore, multi-locus phylogenetic analysis showed the six strains that belong to C.fructicola. Finally, a preliminary screening of nine chemical fungicides to inhibit the strain N by toxicity test identified 40% prochloraz at 0.1 μg mL–1 as the most effective method. The phylogenetic tree analysis revealed a close relationship between the identified strains, and the strains were classified based on cultural, morphological, and molecular characteristics.The findings of this study add to our understanding of C.fructicola, which will aid in the development of preventive measures, the improvement of tea quality, and the assurance of safe production.
Key words: anthracnose, Colletotrichum, fungicide screening, isolation and identification, tea
*Corresponding Author: Jiangfan Yang, Fujian Agriculture and Forestry University, No. 15 Shangxiadian Road, Fuzhou, Fujian, China. Email: [email protected]
Received: 4 November 2021; Accepted: 6 February 2022: Published: 24 March 2022
© 2022 Codon Publications
This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY-NC-SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/)
Tea (Camellia sinensis (L.) O. Kuntze) is one of the most economically important crops in the world. Tea enriched with various beneficial bioactive constituents have been proven to effectively reduce the risk of several diseases in human beings (Rahmani et al., 2015). However, the biotic stress in tea that reduces its economic yield has become a major concern in tea-growing regions globally. According to the preliminary statistics, the occurrence and prevalence of diseases in tea were vary by region. It is more serious in the southern region than in the northern region of China. (Liu et al., 2013).
Anthracnose disease caused by Colletotrichum theae-sinensis is found widely in the tea regions globally, and is one of the main diseases of tea plants in China (Liu et al., 2015; Lu et al., 2018; Wang et al., 2016; Weir et al., 2012). During 2011–2012, anthracnose caused by C. gloeosporioides was observed in about half of the tea plant fields in the Yellow Mountain region in the Anhui Province of China. The symptoms of the disease were observed with small water-soaked lesions in young leaves at the initial stage. As the disease progresses, the lesions become larger and necrotic, finally leading to serious losses in yield (Guo et al., 2014). The disease is also found in the tea regions in Yabukita, Japan, and has been reported to harm tea seedlings and machine-picked or trimmed leaves (Yoshida et al., 2010). The trend of its increasing incidence in tea regions, and the harmful effects on the quality and quantity of economic yield has imposed a raised an alarm on the sustainable development of tea industries. C.camelliae and C.fructicola were the species most often isolated, and were proposed as the dominant pathogens of tea (Lu et al., 2018; Wang et al., 2016). Therefore, it is expected that the taxonomic study of Colletotrichum species in tea plants would be of great significance for the prevention and control of anthracnose disease in tea.
Morphological characteristics and understanding of its host range are important for identifying the strains and distinguishing the relationships in Colletotrichum species. It has been shown that the same anthracnose fungus has a wide host range. Therefore, the occurrence of homologous synonyms over the years has always led to controversy in the taxonomy of this genus (Noireung et al., 2012). With the rapid development of molecular biology techniques, phylogeny has become an important approach to decipher the exact fungal taxonomy. In particular, the application of polygenic locus phylogeny has played a significant role in identifying the different species of anthracnose fungus and deciphering their taxonomic relationships. At present, the anthracnose causing fungi in proteaceae (Liu et al., 2013), guava (Oliveira et al., 2018), chili (Diao et al., 2017), strawberry (Hirayama et al., 2018), mango, and papaya (Oliveira et al., 2018) have been systematically studied.
In this study, we aim to isolate and identify the main pathogenic isolate of Colletotrichum in Zhouning, Longyan, and Ningde (Fujian province, China), as well as evaluate the main pathogen’s susceptibility to nine commercially available chemical fungicides. This results would aid in the development of preventive measures, the improvement of tea quality, and the assurance of safe production.
Colletotrichum infected tea leaves were collected from the tea plantations of Fujian Zhouning Guikelai Organic Tea Co., Ltd. (North latitude 27°6′18″, east longitude 119°20′0″), Fujian Longyan Zhangping County Hung Ding Tea Co., Ltd. (North latitude 25°3′6″, east longitude 117°16′16″), and Fujian Ningde Jiulongfeng Agricultural Development Co., Ltd. (North latitude 26°43′5″, east longitude 119°28′11″) from July 2016 to December 2017. Fujian Zhouning Guikelai Organic Tea Co., Ltd., Fujian Longyan Zhangping County Hung Ding Tea Co., Ltd., and Fujian Ningde Jiulongfeng Agricultural Development Co., Ltd. approved the field site access to this work. The collection sites and times were marked and recorded.
The collected tea leaves with the symptom of the disease were rinsed for 30 min, dried, disinfected with 75% alcohol and 1% mercuric chloride, and rinsed three times with sterile water. The leaves with the lesions were then cut in the dimension of 1 cm×1 cm and inoculated into potato dextrose agar (PDA) containing 1% ampicillin (antibiotic), and placed at 26°C for cultivation (Cai et al., 2009). The pathogen was identified following the guidelines described in the Fungus Identification Handbook (Wei, 1979) after isolation and purification. The purified Colletotrichum strains were separately inoculated into PDA, oat agar (OA), carrot glucose agar (CA), and Czapek-Dox media (Czapek), and cultivated at 26°C for 7 days. The colony diameter was measured using the cross intersect method, and their biological characteristics including growth pattern, change in color, and spore production were observed.
For the measurement of pathogenicity, the wound inoculation method following Koch’s postulates was used. Several fresh and healthy tea leaves of the same size (7 cm × 4 cm) were selected and rinsed with sterile water, disinfected with 75% alcohol, and placed in a culture dish containing cotton balls or filter papers soaked in sterile water. After separation and purification, a puncher was used to obtain 5 mm fungal tablets from the purified pathogens, which were subsequently inoculated onto the wounds made on the leaves by puncturing it through a sterile inoculation needle. The punctured leaves without the pathogen inoculations were used as the control group. All samples were then kept in a moist environment at a stable 26°C.
After five days, the disease symptoms were recorded, and the pathogenic fungal strains were isolated on the emergence of new scabs (Fang, 2001).
The total genomic DNA of the six strains were extracted using Rapid Plant Genomic DNA Isolation Kit (Sangon Biotech, Shanghai, China), and stored at –20°C. The ITS, LSU, β-tub, GS, and CgInt were amplified (Table 1). The protocols for amplification was carried out in 25 μL reaction volumes comprising 2.5 μL 10×Taq PCR buffer, 0.5 μL dNTP mix (10 mM each), 0.3 μL Taq DNA polymerase (5 U μL–1), 1 μL genomic DNA, 1 μL of each primer (10 μM), and 18.7 μL ddH2O. The sample was then amplified in a T100 PCR meter using the following reaction conditions. Predenaturation at 94°C for 10 min, denaturation at 94°C for 5 s, annealing for 45 s (the temperature for each primer are shown in Table 1), extension at 72°C for 1 min for 30 cycles, followed by a final extension at 72°C for 10 min. The PCR products resolved by 1% sepharose electrophoresis were sent to Fuzhou Boshang (Shangchen) Biotech Co., Ltd. for sequencing (Liu, 2013; Mills et al., 1992). The phylogeny tree for each gene of the fungal strains was constructed by using the neighbor-joining bootstrap method (1000 repetitions).
Table 1. Specific primers and annealing temperatures.
| Primer name | Primer sequences (5′–3′) | Annealing temperature (°C) |
|---|---|---|
| ITS1 | TCCGTAGGTGAACCTGCGG | 55 |
| ITS4 | TCCTCCGCTTATTGATATGC | |
| LSU-F | GCATATCAATAAGCGGAGGAAAAG | 57 |
| LSU-R | GGTCCGTGTTTCAAGACGG | |
| β-Tub2F | GGTAACCAAATCGGTCCTGCTTTC | 57 |
| β-Tub2R | ACCCTCAGTGTAGTGACCCTTGGC | |
| GS-F | ATGGCCGAGTACATCTGG | 58 |
| GS-R | GAACCGTCGAAGTTCCAC | |
| CgInt | GGCCTCCCGCCTCCGGGCGG | 57 |
| ITS4 | TCCTCCGCTTATTGATATGC |
The N strain was used to assess the efficiency of the chemical fungicides. The inhibitory activity of the strain was determined by using nine different fungicides (Table 2). A 5 mm tablet of the selected strain was prepared and inoculated into the center of each medium containing the fungicides at different concentrations. The control group was treated with sterile water, placed at 26°C, and cultured for five days. The cross intersect method was used to measure the growth diameter of the colony and determine the inhibition rate of the concentrations of each fungicide (Marais, 1990). The inhibition rate was calculated using the equation mentioned below:
Inhibition rate = (dControl − d)/dControl×100%
where, dControl is the colony diameter of the control group, and d represents the colony diameter of the groups treated with different fungicides.
Using the logarithmic value of the processing concentration (µg mL–1) as the horizontal axis and the corresponding inhibition rate as the ordinate, the toxicity equation was constructed as follows: y = ax + b. The correlation coefficient (r) and the effective concentration (EC50) was calculated, and finally compared the effects of different fungicides on the growth of strain N based on their EC50 values.
Table 2. List of chemical fungicides used in this study.
| Fungicide | Production factory |
|---|---|
| 75% Chlorothalonil wettable powders | Guangdong Zhongxun Agri-science Corporation |
| 10% Difenoconazole water dispersible granule | Qingdao John Sheng Biological Technology Co., Ltd. |
| 50% Cyprodinil water-dispersible granule | Jixi Nonghua Biological Technology Co., Ltd. |
| 70% Cao Tuo thiophanate-methyl | Jiangxi Zhongxun Agrochemical Co., Ltd. |
| 50% Chloroisobromine cyanuric acid | Hebei Shangrui Chemical Co., Ltd. |
| 25% Triadimefon wettable powders | Chengdu Kelilong Biochemical Co., Ltd. |
| 80% Carbendazol | Jiangsu Taicang agrochemical Co., Ltd. |
| 40% Prochloraz water emulsion | Dongguan Ruidefeng Biological Technology Co., Ltd. |
| 50% Azoxystrobin suspension | Shandong Haixun Biochemical Co., Ltd. |
In total, six Colletotrichum isolates were obtained from the tea growing regions in China (Zhouning, Ningde and Longyan). These isolates were isolated from the diseased tissues. In the main tea regions of the East Fujian province, Colletotrichum was widely distributed.
The mycelia of the pathogenic strains were initially observed to be white on the PDA medium, and then became sparse to dense velvet over time. The center of the colony was gray, light-brown, or yellow, and the back was wine red (Figure 1). The conidiophores were either oval or long oval, and black particles were present on the surface. Some particles were binuclear. No gap was observed between the spores. According to Wei Jingchao’s Fungus Identification Handbook, the pathogen strains preliminarily belong to Colletotrichum.
Figure 1. Effects of different media on anthrax mycelium (n = 3)carrot glucose agar (CA), oat agar (OA), Czapek-Dox media (Czapek) and potato dextrose agar (PDA).
As shown in Figure 1, strains A, D, E, and N exhibited rapid growth on the PDA, and slow growth on the Czapek-Dox medium, indicating that the PDA medium is the most suitable for the growth of these strains. On the contrary, B and C strains exhibited rapid growth on the OA and CA medium.
The purified pathogenic strains (A, B, C, D, E, and N) cultivated on the CA medium for seven days revealed round colonies with neat edges and blanket forms. The orangeexudates secreted in the medium were the spores with a flocculent surface. The mycelia of strains A, B, and D were dense, and the mid-front was grayish brown, and the back was rice white. In contrast, the mycelia of the strains C, E, and N were sparse, and the mid-front and back were grayish green, as shown in Figure 2. After cultivating in an OA medium for seven days, round colonies of the strains with neat edges were formed. The mycelia were sparse and transparent, and were attached to the medium. The exudations in the middle and back of the spores were colorless. After cultivating the strains on PDA medium for seven days, the colonies formed were round with neat edges, and were flocculent. The orange secretions in the middle were bulging spores. The strains A, B, and C exhibited melanin pigmentation on their back parts. The front parts of strains A, C, E, and N were taupe, whereas those of strains B and D were beige. The strains cultivated in the Czapek medium for seven days formed irregular colonies. The hyphae were dense, tapetum, and white. The mycelia with beige back grew slowly in the Czapek medium. The spores of the strain A, B, C, D, E, and N showed black particles on the surface.
Figure 2. Morphological identification of anthrax (A, B, C, D, E, N).
The fungal pathogens were inoculated into the healthy tea leaves. It was inoculated continuously for five days, the disease symptoms were observed in a small point at the center of the puncture, which formed brown or black-brown disease spots with the increase in the number of days of cultivation. The symptoms were similar to those of the natural anthracnose disease in the field. Then, the samples were isolated by the conventional tissue separation method. The culture and morphological characteristics of the purified strains and the strains used for the inoculation were the same. The pathogenic strains were preliminarily determined by observing the spores under a microscope. Finally, the same pathogen was separated from the leaves with typical symptoms and it was observed that it fulfilled Koch’s postulates. Based on the symptoms, the morphological characteristics, and pathogenicity, these six strains were identified as Colletotrichum. The N strain was capable of developing the most serious characteristic symptoms of anthracnose as compared to the other strains, whereas the control leaf remained symptomless, which revealed that the N strain was the major pathogen.
The amplified products of the ITS, LSU, β-tub, GS, and CgInt domains from the six strains using the specific primers are shown in Figure 3. The obtained amplicon sizes of ITS (~500 bp), LSU (~500 bp), β-tub 2(500 ~750 bp), GS (500 ~750 bp), and CgInt (~1000 bp) matched the expectations. However, some strains failed to amplify the exact product sizes as shown in Figure 4.
Figure 3. 6 Strains infect the tea leaves. (A) is CK; (B-G) were A, B, C, D, E, N strains that infect the tea leaves.
Figure 4. Primer amplification electrophoresis figure of the specificity of Colletotrichum. M is the marker; 1, 2, 3, 4, and 5 are the amplified fragments of ITS, LSU, β-tub 2, GS, and CgInt, respectively. A, B, C, D, E, and N are the six objective strains.
Bi-directional sequencing was used to determine the sequences, and the sequences ITS, LSU, β-tub, GS, and CgInt were compared using the Basic Local Alignment Search Tool (BLAST) program in the GenBank database. The accession numbers were as follows: 090620, 090621, 094064, 094065, 147730, 147731, 147732, 147733, 147734, 273211, 188770, 188771, 188772, 147824, 147825, 147826, and 149118. The sequences of the genus and species with high similarity with the sequences of the strains were downloaded from the database, and a phylogenetic tree was built using MEGA7.0. The neighbor-joining bootstrap method (1000 repetitions) was adopted for the analysis. As shown in Figure 5, the evolutionary tree belonged to C.fructicola, and different species were located on different branch ends. The strains with close relationships were gathered together on different levels. These results indicate the accuracy of the identification methods. From cultural, morphological, molecular, and pathogenicity, the characteristics of the isolated strains of fungal tea pathogen, the strains were classified under Colletotrichum as C.fructicola.
Figure 5. Phylogenetic tree on the basis of the gene sequence analysis
The efficacies of nine the fungicides on the inhibition of mycelial growth of the N strain was assessed by measuring the growth diameter of their colonies, which revealed different inhibitory effects of the fungicides on the isolated strains (Table 3). Specifically, the treatment with 40% prochloraz at 0.1 μg mL–1 (minimum concentration) did not form any colony on the plate, indicating that it was the most effective fungicide against N strains of anthracnose fungus. EC50 of 50% azoxystrobin suspension and 50% cyprodinil water dispersible granule were 1.63 μg mL–1, 17.54 μg mL–1, which exhibited a good inhibition effect, whereas 80% carbendazol exhibited the worst effect. However, the average value of the measurement was larger than that of the control group, and the inhibition effect was lacking, possibly because the configuration concentration was extremely low. Therefore, the minimum concentration will have to be re-optimized in the future.
Table 3. Measurement of inhibitory effects of different fungicides against the growth of N strain in the laboratory conditions.
| Sl no. | Fungicide | Concentration (μg/mL) |
Inhibition rate (%) | Regression | EC50 (μg/mL) | Correlation coefficient |
|---|---|---|---|---|---|---|
| 1 | 75% Chlorothalonil wettable powders | 40.0 | 35.22 ± 0.36 | y = 0.1306x + 0.1428 | 543.34 | 0.9929 |
| 100.0 | 40.59 ± 0.69 | |||||
| 130.0 | 41.30 ± 0.52 | |||||
| 160.0 | 43.42 ± 0.48 | |||||
| 2 | 10% Difenoconazole water dispersible granule | 66.7 | 20.51 ± 0.85 | y = 0.3977x − 0.4771 | 286.34 | 0.9473 |
| 100.0 | 33.52 ± 0.08 | |||||
| 200.0 | 50.35 ± 0.13 | |||||
| 500.0 | 55.73 ± 0.28 | |||||
| 3 | 50% Cyprodinil water dispersible granule | 0.1 | 2.26 ± 0.17 | y = 0.2143x + 0.2334 | 17.54 | 0.9831 |
| 1.0 | 19.24 ± 0.82 | |||||
| 10.0 | 51.91 ± 0.65 | |||||
| 100.0 | 62.80 ± 0.35 | |||||
| 4 | 70% Cao Tuo Thiophanate-methyl | 0.1 | 17.54 ± 0.19 | y = 0.016x + 0.1762 | 1.7E | 0.7044 |
| 1.0 | 16.55 ± 0.27 | |||||
| 10.0 | 16.83 ± 0.23 | |||||
| 100.0 | 22.77 ± 0.5 | |||||
| 5 | 50% Chloroisobromine cyanuric acid water soluble powder | 200.0 | 7.59 ± 0.95 | y = 0.6326x − 1.4306 | 1126.68 | 0.8971 |
| 400.0 | 13.96 ± 0.48 | |||||
| 600.0 | 26.45 ± 0.51 | |||||
| 800.0 | 49.32 ± 0.43 | |||||
| 6 | 25% Triadimefon wettable powders | 0.1 | 16.55 ± 0.2 | y = 0.0731x + 0.2057 | 10616.75 | 0.8555 |
| 1.0 | 19.38 ± 0.25 | |||||
| 10.0 | 20.37 ± 0.18 | |||||
| 100.0 | 40.59 ± 0.33 | |||||
| 7 | 80% Carbendazol |
533.0 | 0 | |||
| 800.0 | 0 | |||||
| 1600.0 | 0 | |||||
| 4000.0 | 0 | |||||
| 8 | 40% Prochloraz water emulsion | 0.1 | 100% | |||
| 1.0 | 100% | |||||
| 10.0 | 100% | |||||
| 100.0 | 100% | |||||
| 9 | 50% Azoxystrobin suspension | 0.1 | 37.06 ± 0.1 | y = 0.1169x + 0.4751 | 1.63 | 0.9843 |
| 1.0 | 47.52 ± 0.35 | |||||
| 10.0 | 55.45 ± 0.48 | |||||
| 100.0 | 73.40 ± 0.39 |
Colletotrichum is a commonly reported genus, and it causes anthracnose in numerous plants worldwide (Diao et al., 2017; Hirayama et al., 2018; Kumita et al., 2021; Oliveira et al., 2018). Morphologically-based identification of Colletotrichum species has always been problematic, because there are few reliable characters and many of these characters are plastic, and dependent upon methods and experimental conditions. Therefore, DNA sequence analysis has become an important auxiliary approach which has been widely used in the identification and diversity analysis of several fungal species. The six strains isolated in this study demonstrated distinguishing morphological and cultural characteristics. Furthermore, the amplification of the ITS, LSU, β-tub2, GS, and CgInt gene domains from these strains amplified the clear bands as expected. Subsequent sequencing and homologous alignment analysis of the PCR products showed that the degree of similarity between the sequencing results obtained in this study and sequence homology reported by other authors was >97% (Taylor et al., 2000). The phylogenetic tree based on the sequences of these genes showed that the strains A, B, C, D, E, and N could be clustered to C.fructicola.
The study of fungal classification and identification by nucleic acid sequence analysis, especially in the fungal ribosome transcription spacer (rDNA-ITS), has been widely used. ITS is undeniably the best gene used for the classification, and the preferred sequence for fungus bar code engineering (Nilsson et al., 2008). The hypervariable regions in ITS are extremely similar. Hence, for some complex species, ITS cannot provide enough differentiation and support the result. Moreover, the sequences of the different strains in the GenBank are uploaded by different researchers obtained from different studies worldwide, where there is a possibility of errors depending on the works. Therefore, a focus on the other gene sequences with sufficient interspecies resolution such as actin (ACT), calmodulin (CAL), 3-glyceraldehyde phosphate dehydrogenation (GAPDH), chitin synthase 1 (CHS-1), β-TUB2, LSU, and GS have gained increasing research interest. Liu et al. used the morphological identification and the sequence of seven genes to reveal that strains of the C.gloeosporioides complex associated with Proteaceae belong to four known species (C.alienum, C.aotearoa, C.kahawae, C.siamense) and two new taxa (C. proteae and C. grevilleae) (Liu et al., 2013). They then unraveled the phylogenetic diversity of 144 Colletotrichum isolates associated with symptomatic and asymptomatic tissues of C. sinensis, and other Camellia spp. from the seven provinces of China and seven isolates obtained from other countries. Based on the multi-locus phylogenetic analyses and phenotypic characters, 11 species were distinguished (Liu et al., 2015). Wang et al. (2016) collected 106 Colletotrichum isolates from 15 main tea production provinces in China. A multi-locus phylogenetic analysis coupled with morphological identification showed that the isolates belonged to 11 species, including six known species, three new record species, one novel species, and one indistinguishable strain. It is believed that the identification of strains by morphological characteristics, combined with the phylogenetic analysis based on multiple genes, unravels the evolution process of the species closely and determines their taxonomic status more accurately and scientifically. In this study, six isolated strains were accurately and rapidly identified as C.fructicola based on the traditional morphological and molecular methods. The data has been deposited in the National Center for Biotechnology Information (NCBI) database, which could facilitate the comparative analyses of the experimental results of different research teams in different countries.
The pathogenicity of the six strains were tested on the tea leaves. The N strain was capable of developing the most serious characteristic symptoms of anthracnose than the other strains, which revealed that the N strain was the major pathogen. Among the nine tested chemical fungicides, three fungicides (40% prochloraz water emulsion, 50% azoxystrobin suspension, and 50% cyprodinil water dispersible granule) were significant, while the remaining six revealed comparatively weak inhibitory effects. The 40% prochloraz showed the greatest activity in inhibiting the growth of the N strain. Prochloraz is an imidazole fungicide which is widely used around the world in gardening and agriculture to control the growth of the fungi (Vingaard et al., 2006). Gutiérrez-Alonso et al. (2003) showed that C.gloeosporioides is highly sensitive to this fungicide because it acts over the synthesis of ergosterol, the main component of the plasma membrane, so that its absence increases the permeability of the membrane, thereby interrupting the fungal growth (Walsh et al., 2004). Reyes-Estebanez et al. (2019) showed that only prochloraz inhibited up to 83% of C.gloeosporioides growth, which was the best result of inhibition among the treatments.
In this study, the six strains of fungal pathogen isolated from the tea leaves which were identified by cultural, morphological, molecular approaches, and pathogenicity as C.fructicola. Strain N was selected for fungicide susceptibility with the efficacy of 40% prochloraz at 0.1 μg mL–1 as the most effective method for the prevention and treatment of C. fructicola.
The authors declare there are no competing interests.
This study was supported by the Postdoctoral Science Foundation of Fujian Agricultural and Forestry University, and the project of Ningde Normal University (2020Z01, 2020Q101, and 2019T02).
Cai, L., Hyde, K.D., Taylor, P.W.J., Weir, B.S., Waller, J.M., Abang, M.M., Zhang, J.Z., Yang, Y.L., Phoulivong, S., Liu, Z.Y., Prihastuti, H., Shivas, R.G., Mc Kenzie, E.H.C. and Johnston, P.R., 2009. A polyphasic approach for studying Colletotrichum. Fungal Diverisity 39: 183–204. 10.1016/j.riam.2009.11.001
Diao, Y.Z., Zhang, C., Liu, F., Wang, W.Z., Liu, L., Cai, L. and Liu, X.L., 2017. Colletotrichum species causing anthracnose disease of chili in China. Persoonia: Molecular Phylogeny and Evolution of Fungi 38: 20–37. 10.3767/003158517X692788
Fang, Z.D., 2001. The research method of plant disease, 3rd ed. China Agriculture Press, Beijing.
Guo, M., Pan, Y.M., Dai, Y.L. and Gao, Z.M., 2014. First report of brown blight disease caused by Colletotrichum gloeosporioides on camellia sinensis in Anhui province, China. Plant Disease 98: 284. 10.1094/pdis-08-13-0896-pdn
Gutiérrez-Alonso, J.G., Gutiérrez-Alonso, O., Nieto-Angel, D., Téliz-Ortiz, D., Zavaleta-Mejía, E., Delgadillo-Sánchez, F. and Vaquera-Huerta, H., 2003. Evaluación de resistencia a imazalil, prochloraz y azoxystrobin en aislamientos de Colletotrichum loeosporioides (Penz.) Penz. y Sacc. y control de la antracnosis del mango (Mangifera indica L.) en postcosecha. Revista Mexicana De Fitopatología 121: 228–232.
Hirayama, Y., Asano, S., Okayam, K.O., Ohki, S.T. and Tojo, M., 2018. Weeds as the potential inoculum source of Colletotrichum fructicola responsible for strawberry anthracnose in Nara, Japan. Journal of General Plant Pathology 84: 12–19. 10.1007/s10327-017-0753-4
Kumita, K., Kitazawa, Y., Tokuda, R., Miyazaki, A., Maejima, K., Namba, S. and Yamaji, Y., 2021. First report of anthracnose on tillandsia caused by Colletotrichum sp. in Japan. Journal of General Plant Pathology 87: 254–258. 10.1007/s10327-021-00995-x
Liu, F., Damm, U., Cai, L. and Crous, P.W., 2013. Species of the Colletotrichum gloeosporioides complex associated with anthracnose diseases of Proteaceae. Fungal Diversity 61: 89–105. 10.1007/s13225-013-0249-2
Liu, F., Weir, B.S., Damm, U., Crous, P.W., Wang, Y., Liu, B., Wang, M., Zhang, M. and Cai, L., 2015. Unravelling Colletotrichum species associated with Camellia: employing ApMat and GS loci to resolve species in the C.gloeosporioides complex. Persoonia: Molecular Phylogeny and Evolution of Fungi 35: 863–866. 10.3767/003158515X687597
Liu, W., 2013. Anthracnose pathogen identification and the genetic diversity of tea plant. Fujian Agriculture and Forestry University, Fuzhou, China.
Lu, Q.H., Wang, Y.C., Li, N.N., Ni, D.J., Yang, Y.J. and Wang, X.C., 2018. Differences in the characteristics and pathogenicity of Colletotrichum camelliae and C. fructicola isolated from the tea plant (Camellia sinensis (L.) O. Kuntze). Fronties in Microbiology 9: 3060. 10.3389/fmicb.2018.03060
Marais, L., 1990. Efficacy of fungicides against Colletotrichum coccodes on potato tubers. Potato Research 33: 275–281. 10.1007/bf02358457
Mills, P.R., Sreenivasaprasad, S. and Brown, A.E., 1992. Detection and differentiation of Colletotrichum gloeosporioides isolates using PCR. Federation of European Microbiology Societies Microbiology Letters 98: 137–144. 10.1111/j.1574-6968.1992.tb05503.x
Nilsson, R.H., Kristiansson, E., Ryberg, M., Hallenberg, N. and Larsson, K.H., 2008. Intraspecific ITS variability in the kingdom fungi as expressed in the international sequence databases and its implications for molecular species identification. Evolutionary Bioinformatics 4: 193–201. 10.4137/ebo.s653
Noireung, P., Phoulivong, S., Liu, F., Cai, L., Mckenzie, E., Chukeatirote, E., Jones, E.B.G., Bahkali, A. and Hyde, K.D., 2012. Novel species of Colletotrichum revealed by morphology and molecular analysis. Cryptogamie Mycologie 33: 347–362. 10.7872/crym.v33.iss3.2012.347
Oliveira, P.D.L., de Oliveira, K.Á.R., dos Santos Vieira, W.A., Câmara, M.P.S. and de Souza, E.L., 2018. Control of anthracnose caused by Colletotrichum species in guava, mango and papaya using synergistic combinations of chitosan and Cymbopogon citratus (D.C. ex Nees) Stapf. essential oil. International Journal of Food Microbiology 266: 87–94. 10.1016/j.ijfoodmicro.2017.11.018
Rahmani, A.H., Al Shabrmi, F.M., Allemailem, K., Aly, S.M. and Khan, M.A., 2015. Implications of green tea and its constituents in the prevention of cancer via the modulation of cell signalling pathway. BioMed Research International 2015:1–12. 10.1155/2015/925640
Reyes-Estebanez, M., Sanmartín, P., Carlos Camacho-Chab, J., De la Rosa-García, S.C., Jesús Chan Bacab, M., Noemí Águila Ramírez, R., Carrillo-Villanueva, F., De la Rosa-Escalante, E., Luis Arteaga-Garma, J., Serrano, M. and Otto Ortega-Morales, B., 2020. Characterization of a native Bacillus velezensis-like strain for the potential biocontrol of tropical fruit pathogens. Biological Control 141:1–12. 10.1016/j.biocontrol.2020.104127
Taylor, J.W., Jacobson, D.J., Kroken, S., Kasuga, T., Geiser, D.M., Hibbett, D.S. and Fisher, M.C., 2000. Phylogenetic species recognition and species concepts in fungi. Fungal Genetics and Biology 31: 21–32. 10.1006/fgbi.2000.1228
Vingaard, A.M., Hass, U., Dalgaard, M., Andersen, H.R., Bonefeld-Jørgensen, E., Christiansen, S., Laier, P. and Poulsen, M.E., 2006. Prochloraz: an imidazole fungicide with multiple mechanisms of action. International Journal of Andrology 29: 186–192. 10.1111/j.1365-2605.2005.00604.x
Walsh, T.J., Groll, A., Hiemenz, J., Fleming, R., Roilides, E. and Anaissie, E., 2004. Infections due to emerging and uncommon medically important fungal pathogens. Clinical Microbiology and Infection 10: 48–66. 10.1111/j.1470-9465.2004.00839.x
Wang, Y.C., Hao, X.Y., Wang, L., Bin, X., Wang, X.C. and Yang Y.J., 2016. Diverse Colletotrichum species cause anthracnose of tea plants (Camellia sinensis (L.) O. Kuntze) in China. Scientific Reports 6: 35287. 10.1038/srep35287
Wei, J.C., 1979. Fungus identification manual. Shanghai Science and Technology Publishing House. Shanghai, China.
Weir, B.S., Johnston, P.R. and Damm, U., 2012. The Colletotrichum gloeosporioides species complex. Studies in Mycology 73: 115–180. 10.3114/sim0011
Yoshida, K., Ogino, A., Yamada, K. and Sonoda, R., 2010. Induction of disease resistance in tea (Camellia sinensis L.) by plant activators. Japan Agricultural Research Quarterly 44: 391–398. 10.6090/jarq.44.391